Avatar

Atacus7

Atacus7

About

Username
Atacus7
Joined
Visits
94
Last Active

Comments

  • There was definitely server issue. I gave up after an hour of waiting. Having just started the game two days later, my queue time was instant.

  • Thanks all. I see the Steam comments now. Hopefully they will fix the issue soon.

  • Ontario, Canada. Yes, I've got cross play enabled. Have had it on since inception. Thanks for the suggestion.

  • And the game just crashed. And I am punished with a DC penalty. Just over 23000 players on the Bone Chill event. 2024. I am punished because their game crashed. Yet I am here. After all this. $100s of dollars. Ready and willing to play. And yet. They want to ######### me for playing the game. And it crashes. Jesus ######### Christ.

  • I just finished game 5 of tonight. This time I made it to third place. Never was hooked, but the killer had Rancor and I was the obsession, so lucky me, after no escapes so far, they stuck with me until the other two survivors completed the finale gen! Thank BHVR!

  • In what world is a killer that wields four powers "balanced"? I did not play his PTB and in the three hours of games I've played against him, guess how many escapes? ZERO. While I will grant that it can take time to learn how to play against a new killer, I'm being put in games with people who clearly know what they are doing. Between the passive aura read, range hit through walls, pallet hand, , and flying ability he's definitely a challenging killer to verse. Too challenging. While some on here are saying he's too slow during his power, try playing survivor, and watch him absolutely cruze through any power use. Most of those range attack in my games spawn on top of very close to me, so stopping to crouch is literally a decision to get hit or get hit.

  • [Update]: this bug seems to be resolved as of the patch applied yesterday evening.

  • This also happens with Survivor. This is a new bug since the Nicholas Cage chapter released.

  • @Mandy said:

    Legacy cosmetics were given out at a time where the bloodwebs were massive, where you didn't make so many points per match, where there were no 100% BP offerings or Events etc. So it was a lot harder to reach Prestige during that time, especially as the game had only been out a few months.

    Legacy cosmetics will not be returning.

    No one is trying to take away from the challenge of the original gamers who toiled away and were rewarded with the original legacy skins of the past. According to BHVR, the new prestige system reduces the grind by 75%! So nor should anyone use the past to take away from the efforts of gamers who put in their time, love, and devotion to P3 their characters with the current system. Everyone on here who says we shouldn't have them has self-imposed reasons we can't have them: we can't have them because then everyone would have them, or what about licensed characters, or what about, what about, and what about... Thanks for your astute insight. Literally the only reason they're not being offered is because BHVR doesn't want to do them. That's it. But it's not like they even have to be super complicated. I'd be happy if they simply took the current bloody P3 cosmetic and made it glowy and shiny. Easy and something I can bring into a match to show off.

  • whispers into the devs ears... LLEEEEEEEGGGGGAAAAAAACCCCCCCCCIIIEEEEEEEEE

  • @deKlaw_04 said:

    https://forum.deadbydaylight.com/en/discussion/comment/3043670#Comment_3043670

    They were very clear they weren’t gonna do it. 1) they don’t want exclusive stuff. 2) the license characters wouldn’t be able to get anything

    thanks for restating the company line. I feel they should change their minds and make something EXCLUSIVE. That's the definition of a REWARD! Right?

  • @shinymon said:

    No more legacy cosmetics. Those were so ugly and the only reason they are coveted so much is because they are no longer available. At best they should apply that special glittery filter towards the new prestige icons or make them unique altogether for those who P3'd that way everyone could see it but even that's a stretch.

    I guess that's an opinion. I wouldn't mind even a NEW LEGACY cosmetic. Take LEGACY and make it a different color. Would still be better than a portrait with a cheap game effect.

  • MMAAAAAAYYYBEEEEE they should CHANGE THEIR MINDS... hmmmmmm?????

  • This happened with me against a nurse on the Game map. I don't think it matters if it's a particular killer or map. I rush exited the locker before the killer opened the locker. Locker exit animation completed. Half a second later I'm being hoisted up onto her shoulder!! It's like the animation has a delay after it completes, locking you in place, and allow very generous hits or grabs to killers. This is the same with window vaults. I can't count how many times I've vaulted a window or pallet, animation complete, I continue running only to be hit by a late swing from the killer on the other side of the window. Why does ping afford so much advantage to killers? It's like the 5th perk for killer.

  • This has happened to me a few times. Once the game starts doing this, the only way to make it stop is by restarting it. Thing is, it can happen at any time including while you're in public lobby. So if you were leveling up one survivor but planning to play another, you're stuck with whoever you were leveling up. And hopefully you have perks on them. I got stuck with a survivor I was leveling up and just P3'd, so I hadn't put any perks of them yet when my bloodweb froze at the end of the level. Had to play them that match as there was no way to change survivor or even exit the lobby. Thankfully the match went well and against a Freddy of all killers! Fortunately, this bug does not happen very often.

  • I think this was an issue with my gaming controller. I was using a Playstation 4 controller on PC and a special driver I found online. This driver was causing all sorts of issues as well with my sound. I uninstalled it and now use a different controller made for PC. This issue has gone away for me.

  • Same thing for me. The game is literally unplayable after this bug starts because you are blocked from finding a lobby. The only thing I've been able to do to get back in is to restart the whole game but even that's not guaranteed, and even if you do make it into a lobby, on the next game the bug is back!

  • Can't use a key in the dying state? Since when? I've been downed on hatch with key and had no problem using it.

  • I just had a game on Badham against Pyramid Head. I was the last survivor with a skeleton key (pink key). Killer closed hatch and saw me. After chasing me for a bit I made it to the hatch well ahead of the killer. I was literally in front of and then standing on the hatch but the only prompt I got was Mind Channel (had the wedding ring attached). Even after downing me there was no prompt. So frustrating.

  • This has happened to me three or four times. It snags you and you can't get out unless killer hits you.